View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4572-Insertion-10 (Length: 237)
Name: NF4572-Insertion-10
Description: NF4572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4572-Insertion-10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 17 - 146
Target Start/End: Complemental strand, 34825646 - 34825517
Alignment:
| Q |
17 |
atgtgtatttcttttaggcattattgatatcttaggaatagcatgtgtgctgcaaatatgattagtactattgttgcttgacatgcaagcttaaatgaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34825646 |
atgtgtatttcttttaggcattattgatatcttaggaatagcatgtgtgctgcaaatatgattagtactattgttgcttgacatgcaagcttaaatgaca |
34825547 |
T |
|
| Q |
117 |
actgaattctaacataagcaatttcaaata |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34825546 |
actgaattctaacataagcaatttcaaata |
34825517 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 142 - 237
Target Start/End: Complemental strand, 34825275 - 34825180
Alignment:
| Q |
142 |
aaatatctccacaaaaacatgtggtgtgatctgacctgatgcatgtgtaaaaaacaatcatacaatcggtgtatacaaattaaatctatattatta |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34825275 |
aaatatctccacaaaaacatgtggtgtgatctgacctgatgcatgtgtaaaaaacaatcatacaatcggtgtatacaaattaaatctatattatta |
34825180 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University