View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4572-Insertion-12 (Length: 160)
Name: NF4572-Insertion-12
Description: NF4572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4572-Insertion-12 |
 | |
|
| [»] chr1 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 8 - 160
Target Start/End: Original strand, 7296763 - 7296914
Alignment:
| Q |
8 |
atacactcattaaaaaagagctctttaagctgtatcatgttctttagagttagagtagttatgcatatgagttgttagttactttccaattgtctaaagg |
107 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
7296763 |
atacacttattaaaaaagagctctttaagctgtatcatgttctctagagttagagcagttatgcatatgagttgttagttactttccaa-tgtctaaagg |
7296861 |
T |
|
| Q |
108 |
ttctgaaaatggtaaatacatatagatatacgagaggctgatcatgtatgagt |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
7296862 |
ttctgaaaatggtaaatacatatagatatacgagaggctgatcctgtatgagt |
7296914 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University