View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4572-Insertion-13 (Length: 121)
Name: NF4572-Insertion-13
Description: NF4572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4572-Insertion-13 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 110; Significance: 7e-56; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 110; E-Value: 7e-56
Query Start/End: Original strand, 8 - 121
Target Start/End: Original strand, 53272050 - 53272163
Alignment:
| Q |
8 |
taataatggtacattcagcattaaatgtagtatctgattgtacgttgtaaagctgtagtatcttataaatatgcatgtcggctgttatttactattttta |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
53272050 |
taataatggtacattcagcattaaatgtagtatctgattgtacgttgtaaagctgtagtatcttataaatatgcatgtcagctgttatttactattttta |
53272149 |
T |
|
| Q |
108 |
aatagaattcgcag |
121 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
53272150 |
aatagaattcgcag |
53272163 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University