View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4572-Insertion-9 (Length: 256)
Name: NF4572-Insertion-9
Description: NF4572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4572-Insertion-9 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 6 - 256
Target Start/End: Original strand, 30842704 - 30842956
Alignment:
| Q |
6 |
catccacttcaggtaaatcaattcaattatattggtagaaaaattgctgacaaatatttgccatgacatata---ttgttgtgattaaatttgttgaagt |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
30842704 |
catccacttcaggtaaatcaattcaattatattggtagaaaaattgctgacaaatatttgccatgacatatattgttgttgtgaataaatttgttgaagt |
30842803 |
T |
 |
| Q |
103 |
tgagaatgtctatttttcaaaagaaattgaaggttatattactatagttatgtggatgttatgcttaa-cagtgtagaatttctctttacgccctcaata |
201 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| ||||||||||||||||||| |||| |||||| |
|
|
| T |
30842804 |
tgagaatctctatttttcaaaagaaattgaaggttgtattactatagt--tgtggatgttatgcttaaccagtgtagaatttctctttgcgccttcaata |
30842901 |
T |
 |
| Q |
202 |
tctctaagaccccgaaatcataacattgtagtccagaaaacggaaattgatcctc |
256 |
Q |
| |
|
||||||||||||||||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
30842902 |
tctctaagaccccgaaatcataacattgtagcctagaaaacggaaattgatcctc |
30842956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University