View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4572_high_10 (Length: 268)
Name: NF4572_high_10
Description: NF4572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4572_high_10 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 14 - 252
Target Start/End: Complemental strand, 38124832 - 38124596
Alignment:
| Q |
14 |
cacagacaagcacacacaaaaacaaattcagctgtgtaagtagaaaaaagtgttttcaactgtagatcgtggaatatagcagtttgttcaaactctatta |
113 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38124832 |
cacagacaagcacaca--aaaacaaattcagctgtgtaagtagaaaaaagtgttttcaagtgtagatcgtggaatatagcagtttgttcaaactctatta |
38124735 |
T |
|
| Q |
114 |
agctacagagtttcatagctactatttgacatcactttgttctaaacagcgtatcacgaaccaatagcaatttatttaaattccatagcactgtagctac |
213 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38124734 |
agttacagagtttcatagctactatttgacatcactttgttctaaacagcgtatcacgaaccaatagcaatttatttaaattccatagcactgtagctac |
38124635 |
T |
|
| Q |
214 |
nnnnnnnacagtggtagaaaatataccggggcacatacg |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
38124634 |
tttttttacagtggtagaaaatataccggggcacatacg |
38124596 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 136 - 180
Target Start/End: Original strand, 13510301 - 13510345
Alignment:
| Q |
136 |
tatttgacatcactttgttctaaacagcgtatcacgaaccaatag |
180 |
Q |
| |
|
|||||||||||||||||| ||||| ||||| ||||||| |||||| |
|
|
| T |
13510301 |
tatttgacatcactttgtactaaatagcgtttcacgaaacaatag |
13510345 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University