View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4572_high_12 (Length: 237)
Name: NF4572_high_12
Description: NF4572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4572_high_12 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 2080099 - 2080321
Alignment:
| Q |
1 |
aaactacaaagattaagaaaatgttatggattcagccgcattgaggcaggccattagattaagtttctcgcaaaacaatgcagaatgtttgaactttgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2080099 |
aaactacaaagattaagaaaatgttatggattcagccgcattgaggcaggccattagattaagtttctagcaaaacaatgcagaatgtttgaactttgaa |
2080198 |
T |
|
| Q |
101 |
ggctagctttagacaggatcaaaatgctttgacaagagtgctttcttggaacttttttgcctctcaaccaaaagcatgcaatttgtccaatggtatgcta |
200 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2080199 |
ggctagctttagacaggatcaaaaagctttgacaagagtgctttcttggaacttttttgcctctcaaccaaaagcatgcaatttgtccaatggtatgcta |
2080298 |
T |
|
| Q |
201 |
attggggagaggaagttggttgt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
2080299 |
attggggagaggaagttggttgt |
2080321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University