View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4572_high_17 (Length: 218)
Name: NF4572_high_17
Description: NF4572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4572_high_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 4103040 - 4103231
Alignment:
| Q |
18 |
cattgtagttgccatggttattctggtactcattgttgttaccatagttattattattgttgtaccagttattattgttgttcactcctctagatgaatc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4103040 |
cattgtagttgccatggttattctggtactcattgttgttaccatagttattattattgttgtaccagttattattgttgttcactcctctagatgaatc |
4103139 |
T |
|
| Q |
118 |
accatacattgttggattgtacttttcatagttaacatcatagaaatattttccaccttccaaaaatcttgtgtcactcatcctttgcttct |
209 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
4103140 |
accatacattgttggattgtacttttcatagttaacatcatagaaatattttccaccttccaaaaatcttgtgtcactcatcccttgtttct |
4103231 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 147 - 198
Target Start/End: Complemental strand, 34999950 - 34999899
Alignment:
| Q |
147 |
agttaacatcatagaaatattttccaccttccaaaaatcttgtgtcactcat |
198 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| || ||| ||||||||||| |
|
|
| T |
34999950 |
agttaacatcataaaaatattttccaccttccataactctcgtgtcactcat |
34999899 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University