View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4572_high_9 (Length: 279)
Name: NF4572_high_9
Description: NF4572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4572_high_9 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 4e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 4e-81
Query Start/End: Original strand, 9 - 201
Target Start/End: Complemental strand, 56302139 - 56301947
Alignment:
| Q |
9 |
atgaagaccatttttattgtcaaa--gaattgagagatcagttagaaacacttcagaattgtgatcataagtttgaaaattgtccaaaatcaatcaaaga |
106 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
56302139 |
atgaagaccatttttattgtcaaaaagaattgagagatcagctagaaacacttcagaactgtgatcataagtttgaaaattgtcctaaatcaattaaaga |
56302040 |
T |
 |
| Q |
107 |
aagcaaatgatcaaagccataaaagtagaggttgttatgccagttattataccccgaactacgacggtaaatcttaataaataaaatttgttctt |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
56302039 |
aagcaaatgatcaaagccataaaagtagaggttgttatgccagttat--taccccgaactacgacggtaaatattaataaataaaatttgttctt |
56301947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 203 - 261
Target Start/End: Complemental strand, 56301916 - 56301859
Alignment:
| Q |
203 |
taataccatcctttaaagccttataatatctgaatggtgtaagaaatcataatgtttag |
261 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
56301916 |
taataccatcctt-aaggccttataatatctgaatggtgtaagaagtcataatgtttag |
56301859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University