View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4572_low_9 (Length: 283)
Name: NF4572_low_9
Description: NF4572
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4572_low_9 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 20 - 283
Target Start/End: Original strand, 29683794 - 29684057
Alignment:
| Q |
20 |
catacctgattgtgcagagaaggaggaagacatgatcgtttctttttcttctgaacgctgaaacttctttatctcgttgaannnnnnnn-gtgtgcactt |
118 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
29683794 |
catacctgattgtgtagagaaggaggaagacatgatcgtttctttttcttctgaacgctgaaacttctttatctcgttgaatttttttttgtgtgcactt |
29683893 |
T |
 |
| Q |
119 |
tttcttatggtttgcaagccaatttatagataatgaggttagggtttctttttgaggttgctttatggacaagaaagtaatttgttgagattttttcggc |
218 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29683894 |
tttcttatggtt-gcaagccaatttatagataatgaggttagggtttctttttaaggttgctttatggacaagaaagtaatttgttgagattttttcggc |
29683992 |
T |
 |
| Q |
219 |
tagaataattatttagatttggatttaatacatctttcgtatgatcaatcctaaaaaagaccatt |
283 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
29683993 |
tacaataattatttagatttggatttaatacatctttcgtatgatcaatcctaaaaaaaaccatt |
29684057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University