View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4573_high_6 (Length: 209)
Name: NF4573_high_6
Description: NF4573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4573_high_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 169; Significance: 8e-91; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 169; E-Value: 8e-91
Query Start/End: Original strand, 19 - 199
Target Start/End: Complemental strand, 43186296 - 43186116
Alignment:
| Q |
19 |
agcaattataacagccatgattaagatcaagggctagaaaggaactgtcactttaagtttgttttaaaatagtttaatgcaatctatgtacttggtgtat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43186296 |
agcaattataacagccatgattaagatcaagggctagaaaggaactgtcactttaagtttgttttaaaatagtttaatgcaatctatgtacttggtgtat |
43186197 |
T |
|
| Q |
119 |
tttttaattagtgataatttgtaatattggttagctaaacaatgcaaaatacattctcttaagactagtgtctgtgctcct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||| |||| |
|
|
| T |
43186196 |
tttttaattagtgataatttgtaatattggttagctaaacaatgcaaaatacattctcttatgactagtgtcagtggtcct |
43186116 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 148 - 188
Target Start/End: Complemental strand, 5039519 - 5039479
Alignment:
| Q |
148 |
gttagctaaacaatgcaaaatacattctcttaagactagtg |
188 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||| ||||| |
|
|
| T |
5039519 |
gttagctaaccaatgcaaaagacattctcttaagattagtg |
5039479 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University