View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4573_low_5 (Length: 281)
Name: NF4573_low_5
Description: NF4573
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4573_low_5 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 19 - 265
Target Start/End: Original strand, 41095472 - 41095720
Alignment:
| Q |
19 |
agtaatacatccaagttggatgcacccaacctagtttctggcattacatcgatcgagataactttgaacaagatccacacatcgttgcatatatgaaatg |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41095472 |
agtaatacatccaagttggatgcacccaacctagtttctggcattacatcgatcgagataactttgagcaagatccacacatcgttgcatatatgaaatg |
41095571 |
T |
|
| Q |
119 |
ttggtcttcacatgataatcacaccacaatcatgtgtaaatcatatagaatgaccataataaactttcgatcaacatataacttgttattgtccctc--- |
215 |
Q |
| |
|
||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
41095572 |
ttggtcttcacgtgataatcacaccacaatca--tgtaaatcatatagaatgaccataataaacgttcgatcaacatataacttgttattgtccctcaaa |
41095669 |
T |
|
| Q |
216 |
-nnnnnnnntataacttgtttattaatttaccaacttttattaacattcat |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41095670 |
aaaaaaaaatataacttgtttattaatttaccaacttttattaacattcat |
41095720 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University