View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4574-Insertion-5 (Length: 140)
Name: NF4574-Insertion-5
Description: NF4574
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4574-Insertion-5 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 8 - 140
Target Start/End: Complemental strand, 10751884 - 10751752
Alignment:
| Q |
8 |
tgattcaccttgtatattgtatgcataagaaggccatcttacatcagcttcgcacatgctcgcaacactcattccgatcatcttctgtgttctttcaaga |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
10751884 |
tgattcaccttgtatattgtatgcataagaaggccatcttacatcagcttcgcacatgctcgcgacactcattccgatcatcttctgtgttctttcaaga |
10751785 |
T |
|
| Q |
108 |
actataagacttgaaaatgtggagaaactgttt |
140 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10751784 |
actataagacttgaaaatgtggagaaactgttt |
10751752 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 49; Significance: 2e-19; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 49; E-Value: 2e-19
Query Start/End: Original strand, 83 - 139
Target Start/End: Complemental strand, 32561256 - 32561200
Alignment:
| Q |
83 |
gatcatcttctgtgttctttcaagaactataagacttgaaaatgtggagaaactgtt |
139 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
32561256 |
gatcatcttttgtgttctttcaagaactataagacttgaaaatgtagagaaactgtt |
32561200 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 28; E-Value: 0.0000007
Query Start/End: Original strand, 10 - 53
Target Start/End: Complemental strand, 32561329 - 32561286
Alignment:
| Q |
10 |
attcaccttgtatattgtatgcataagaaggccatcttacatca |
53 |
Q |
| |
|
|||| |||| |||||| |||||| |||||||||||||||||||| |
|
|
| T |
32561329 |
attctccttttatattatatgcaaaagaaggccatcttacatca |
32561286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University