View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4575_low_10 (Length: 241)
Name: NF4575_low_10
Description: NF4575
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4575_low_10 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 8 - 222
Target Start/End: Complemental strand, 10752094 - 10751880
Alignment:
| Q |
8 |
ctttactatctattaagtgtgctaatcaaactctggaagtgaaaaatgtgtagacaaaataatcaggctgttaaactaaactactcaaaattttatgtca |
107 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
10752094 |
ctttaccatctatgaagtgtgctaatcaaactctggaagtgaaaaatgtgtagacaaaataatcaggccgttaaactaaactactcaaaattttatgtca |
10751995 |
T |
|
| Q |
108 |
gaagcagaaaattaaatatgacccttgcaatcatagatatgattggtgccatagcttattgtttgaagacttgattcagacatatttgtaatccatctca |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10751994 |
gaagcagaaaattaaatatgacccttgcaatcatagatatgattggtgccatagcttattgtttgaagacttgattcagacatatttgtaatccatctca |
10751895 |
T |
|
| Q |
208 |
ttgcaccatttgatt |
222 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
10751894 |
ttgcaccatttgatt |
10751880 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 153 - 217
Target Start/End: Complemental strand, 32561396 - 32561332
Alignment:
| Q |
153 |
gtgccatagcttattgtttgaagacttgattcagacatatttgtaatccatctcattgcaccatt |
217 |
Q |
| |
|
||||||||||| || | ||||| ||||| |||||||||||||||| ||||||||| | |||||| |
|
|
| T |
32561396 |
gtgccatagctgatagcatgaaggcttgaatcagacatatttgtaacccatctcataggaccatt |
32561332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University