View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4576-Insertion-15 (Length: 136)
Name: NF4576-Insertion-15
Description: NF4576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4576-Insertion-15 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 129; Significance: 4e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 129; E-Value: 4e-67
Query Start/End: Original strand, 8 - 136
Target Start/End: Original strand, 42746330 - 42746458
Alignment:
| Q |
8 |
ggttgaacaacatgagtcaaagcccaaaccaaagcagttcttgaaatatattttgaagctttcactgcaactataacaaccttagaggaagaactcattt |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42746330 |
ggttgaacaacatgagtcaaagcccaaaccaaagcagttcttgaaatatattttgaagctttcactgcaactataacaaccttagaggaagaactcattt |
42746429 |
T |
 |
| Q |
108 |
cttctacataatgatgacccttttgttta |
136 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42746430 |
cttctacataatgatgacccttttgttta |
42746458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University