View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4576_high_10 (Length: 258)
Name: NF4576_high_10
Description: NF4576
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4576_high_10 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 68 - 242
Target Start/End: Original strand, 39741956 - 39742130
Alignment:
| Q |
68 |
cggtgttcttcaaatgatgatgccggaagaggagccgatgacggttttaacaacttgggtgaatgaaattgatgtgcaaaagagattaggtttccaatga |
167 |
Q |
| |
|
||||| |||||| |||||||||||||||| |||| |||||| ||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
39741956 |
cggtggtcttcagatgatgatgccggaaggggaggcgatgagggttttaacaacttgggtgaatgaaattgttgtgcaaaggagattaggtttccaatga |
39742055 |
T |
 |
| Q |
168 |
gatatgatattgaaaggaggtgatgggaggggaaatgagagaaagagaaagcttaatcttaactctgaagaaact |
242 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||||||| ||| |||| || ||||||||||||||| |
|
|
| T |
39742056 |
gatatgatattgaaatgaggtgatggaaggggaaatgagagaaagaggaagtttaagctgaactctgaagaaact |
39742130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 123; Significance: 3e-63; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 68 - 242
Target Start/End: Original strand, 6898414 - 6898588
Alignment:
| Q |
68 |
cggtgttcttcaaatgatgatgccggaagaggagccgatgacggttttaacaacttgggtgaatgaaattgatgtgcaaaagagattaggtttccaatga |
167 |
Q |
| |
|
||||| |||||| |||||||||||||||| |||| |||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
6898414 |
cggtggtcttcagatgatgatgccggaaggggaggcgatgagggttttaacaacttgggtgaatgaaattgttgtgcaaaagagattaggttttcaatga |
6898513 |
T |
 |
| Q |
168 |
gatatgatattgaaaggaggtgatgggaggggaaatgagagaaagagaaagcttaatcttaactctgaagaaact |
242 |
Q |
| |
|
||||||||||||||| |||||||||| |||||||||||||||||||| ||| |||| || ||||||||||||||| |
|
|
| T |
6898514 |
gatatgatattgaaatgaggtgatggaaggggaaatgagagaaagaggaagtttaagctgaactctgaagaaact |
6898588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 71; Significance: 3e-32; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 52 - 218
Target Start/End: Original strand, 33619422 - 33619594
Alignment:
| Q |
52 |
tgcatacctccttcgacggtgttcttcaaatgatgatgccggaagaggagccgatgacggttttaacaacttgggtgaatgaaattgatgtgc------- |
144 |
Q |
| |
|
||||||||||| |||| |||| |||| | |||||||||||||| | |||| |||||| ||||||||||||||||||||||||||||| ||||| |
|
|
| T |
33619422 |
tgcatacctccatcgaaggtggtctttagatgatgatgccggagggggaggcgatgagggttttaacaacttgggtgaatgaaattgttgtgcttactcg |
33619521 |
T |
 |
| Q |
145 |
-aaaagagattaggtttccaatgagatatgatattgaaaggaggtgatgggaggggaaatgagagaaagagaaag |
218 |
Q |
| |
|
| |||||||||||||| | ||||| ||||||||||||||||||||| ||||||||||||||||| ||||||| |
|
|
| T |
33619522 |
ttatagagattaggtttctattgagaaatgatattgaaaggaggtgat--gaggggaaatgagagaaggagaaag |
33619594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University