View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4577-Insertion-18 (Length: 182)
Name: NF4577-Insertion-18
Description: NF4577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4577-Insertion-18 |
 | |
|
| [»] scaffold0662 (1 HSPs) |
| |
|
| [»] scaffold0702 (1 HSPs) |
| |
|
| [»] chr8 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0662 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: scaffold0662
Description:
Target: scaffold0662; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 7 - 182
Target Start/End: Original strand, 2766 - 2941
Alignment:
| Q |
7 |
agagggagtcactgtgcccaaaacctgatagaggacaagatcaaactttgagcaaactactgaaggagaaaggtaacgtgtttgctactctcgaagaaag |
106 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||| ||||||||| ||||||| |
|
|
| T |
2766 |
agagggagtcactgtgcccaaaacctgatagaggacaagatcaaactttgagcaaactactgaaggagaaaagcaacgtgttggctactctcaaagaaag |
2865 |
T |
|
| Q |
107 |
gagcataaagatcagataaagaagaacatcacaattcacaagcatcaacctcttttggaaaatgcttctaaccata |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2866 |
gagcataaagatcagataaagaagaacatcacaattcacaagcatcaacctcttttggaaaatgcttctaaccata |
2941 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0702 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: scaffold0702
Description:
Target: scaffold0702; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 7 - 182
Target Start/End: Complemental strand, 5329 - 5155
Alignment:
| Q |
7 |
agagggagtcactgtgcccaaaacctgatagaggacaagatcaaactttgagcaaactactgaaggagaaaggtaacgtgtttgctactctcgaagaaag |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||| ||||||| |
|
|
| T |
5329 |
agagggagtcactgtgcccaaaacctgatagaggacaagatcaaactttgagcaaactactgaaggagaaagc-aacgtgttggctactctcaaagaaag |
5231 |
T |
|
| Q |
107 |
gagcataaagatcagataaagaagaacatcacaattcacaagcatcaacctcttttggaaaatgcttctaaccata |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5230 |
gagcataaagatcagataaagaagaacatcacaattcacaagcatcaacctcttttggaaaatgcttctaaccata |
5155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 148; Significance: 2e-78; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 2e-78
Query Start/End: Original strand, 7 - 182
Target Start/End: Complemental strand, 35172022 - 35171847
Alignment:
| Q |
7 |
agagggagtcactgtgcccaaaacctgatagaggacaagatcaaactttgagcaaactactgaaggagaaaggtaacgtgtttgctactctcgaagaaag |
106 |
Q |
| |
|
|||||||||||||||| ||||| |||||||||||||||||||||||| ||||||| |||||||||||||| | |||||||||||||||||||||||||| |
|
|
| T |
35172022 |
agagggagtcactgtgttcaaaatctgatagaggacaagatcaaacttcgagcaaaatactgaaggagaaaagcaacgtgtttgctactctcgaagaaag |
35171923 |
T |
|
| Q |
107 |
gagcataaagatcagataaagaagaacatcacaattcacaagcatcaacctcttttggaaaatgcttctaaccata |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35171922 |
gagcataaagatcagataaagaagaacatcacaattcacaagcatcaacctcttttggaaaatgcttctaaccata |
35171847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University