View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4577-Insertion-20 (Length: 155)
Name: NF4577-Insertion-20
Description: NF4577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4577-Insertion-20 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 132; Significance: 7e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 132; E-Value: 7e-69
Query Start/End: Original strand, 8 - 155
Target Start/End: Complemental strand, 30479498 - 30479351
Alignment:
| Q |
8 |
gaatgttcataatcaatatacctagagaagtaacaatcacatttcgtggctttgtgcatgctattcaatgcatttatgcttttatgacaaatttcaattc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
30479498 |
gaatgttcataatcaatatacctagagaagcaactatcacatttcgtggctttgtgcatgctatgctatgcatttatgcttttatgacaaatttcaattc |
30479399 |
T |
 |
| Q |
108 |
gacaatttactcttatgtgagttgtagttctatacattgcttcttgta |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30479398 |
gacaatttactcttatgtgagttgtagttctatacattgcttcttgta |
30479351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University