View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4577-Insertion-21 (Length: 147)
Name: NF4577-Insertion-21
Description: NF4577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4577-Insertion-21 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 95; Significance: 8e-47; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 95; E-Value: 8e-47
Query Start/End: Original strand, 44 - 146
Target Start/End: Complemental strand, 54279358 - 54279256
Alignment:
| Q |
44 |
cttaatgagcattgctatttgtcgtgaacgtaattccatgaaggcatttctaccgttagatgttcctttcacggaatacgtgagtggctggatttaaatt |
143 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
54279358 |
cttagtgagcattgctatttgtcgtgaacgtaattccatgaaggcatttctaccgttagatgttcctttcacggaatacatgagtggctggatttaaatt |
54279259 |
T |
 |
| Q |
144 |
agc |
146 |
Q |
| |
|
||| |
|
|
| T |
54279258 |
agc |
54279256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000002
Query Start/End: Original strand, 73 - 111
Target Start/End: Complemental strand, 54279394 - 54279356
Alignment:
| Q |
73 |
gtaattccatgaaggcatttctaccgttagatgttcctt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54279394 |
gtaattccatgaaggcatttctaccgttagatgttcctt |
54279356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000005
Query Start/End: Original strand, 96 - 145
Target Start/End: Original strand, 25980997 - 25981046
Alignment:
| Q |
96 |
ccgttagatgttcctttcacggaatacgtgagtggctggatttaaattag |
145 |
Q |
| |
|
|||||||||| |||||||||||||||| || |||| ||||| |||||||| |
|
|
| T |
25980997 |
ccgttagatgctcctttcacggaatacatgggtggttggatgtaaattag |
25981046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University