View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4577_high_12 (Length: 234)
Name: NF4577_high_12
Description: NF4577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4577_high_12 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 39809994 - 39810208
Alignment:
| Q |
1 |
tttcataaactccttcaaagagtttcgcgagtgtttatgttagtagataagctagctagctcaaataagttaatctaaacatacc---ttattattaatt |
97 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
39809994 |
tttcataaactccttcaaagagtttcgcgagtgtttatgttagtagataagctagctagctcaaataagttaatctattcataccttattattattaatt |
39810093 |
T |
|
| Q |
98 |
gatatctttcctaatattactattgtgaaagctatgatcatatgtatgtaaatgcaatgtttgatcaatgatcatggccttggcttttatacagtttgca |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
39810094 |
gatatctttcctaatattactattgtgaaagctatgatcatatgtatgtaaatgcaatgtt-------tgatcatggccttggcttttatacagtttgca |
39810186 |
T |
|
| Q |
198 |
tggattggtacgaggagaaaac |
219 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
39810187 |
tggattggtacgaggagaaaac |
39810208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University