View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4577_high_15 (Length: 213)
Name: NF4577_high_15
Description: NF4577
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4577_high_15 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 171; Significance: 5e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 171; E-Value: 5e-92
Query Start/End: Original strand, 17 - 195
Target Start/End: Original strand, 55163359 - 55163537
Alignment:
| Q |
17 |
cacagacaatgatttcaacaacttaccatcaggtgatgtggtggataaacttcttcaagagtggcaaactagttctgtacaaggtatcacagatgagcat |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55163359 |
cacagacaatgatttcaacaacttaccatcaggtgatgtggtggataaacttcttcaagagtggcaaactagttctgtacaaggtatcacagatgagcat |
55163458 |
T |
|
| Q |
117 |
ggttcaaatagcttttatggattcttaggagaatatagaattagggtcgagtatcgcaacaagactatagattcaactt |
195 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
55163459 |
ggttcacatagcttttatggattcttaggagaatatagaattagggtcgagtatcgcaacaagactataaattcaactt |
55163537 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University