View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4578_high_8 (Length: 215)
Name: NF4578_high_8
Description: NF4578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4578_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 159; Significance: 8e-85; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 159; E-Value: 8e-85
Query Start/End: Original strand, 1 - 205
Target Start/End: Original strand, 1307350 - 1307555
Alignment:
| Q |
1 |
ttttagtgtttaggtgaatagttgtagtagaaacacactgtttggtgttaatttgaatgtttatgaacttgatttcggtctagnnnnnnnnn-gtagtaa |
99 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||| |
|
|
| T |
1307350 |
ttttagtgtttaggtgaatatttgtagtagaaacacactgtttggtgttaatttcaatgtttatgaacttgatttcggtctagttttttttttgtagtaa |
1307449 |
T |
|
| Q |
100 |
tttttatagtgtgttgagttaaatatttagttataggttattttgtgcatagagtcataataattttgaatattaatggacttgattgaaatgtgtactg |
199 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1307450 |
tttttatagtgtgttgagttaactatttagttataggttattttgtgcatagagtcataataattttgaatattaatggacttgattgaaatgtgtactg |
1307549 |
T |
|
| Q |
200 |
cctttg |
205 |
Q |
| |
|
|||||| |
|
|
| T |
1307550 |
cctttg |
1307555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 41 - 75
Target Start/End: Original strand, 1307287 - 1307321
Alignment:
| Q |
41 |
tttggtgttaatttgaatgtttatgaacttgattt |
75 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1307287 |
tttggtgttaatttgaacgtttatgaacttgattt |
1307321 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University