View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4578_high_9 (Length: 205)
Name: NF4578_high_9
Description: NF4578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4578_high_9 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 12 - 188
Target Start/End: Complemental strand, 30888744 - 30888568
Alignment:
| Q |
12 |
agcagagaaataattgatgtggtcgggtccatggtaaaacgatgcgtaactaactcatcactttgagtcnnnnnnnctcatcacaatcaagattatattt |
111 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30888744 |
agcagagaaataattgatgtggtcgggtccatggtaaaacgatgcgtaactaactcatcactttgagtcaaaaaaactcatcacaatcaagattatattt |
30888645 |
T |
 |
| Q |
112 |
atgaagttatgaacgaagaattcgtgagaagctagaaccgttggatgtttattcacaatcattggacatgagatctt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
30888644 |
atgaagttatgaacgaagaattcgtgagaagctagaaccgttggatgtttattcacaatcattggacatgaaatctt |
30888568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University