View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4578_low_2 (Length: 363)
Name: NF4578_low_2
Description: NF4578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4578_low_2 |
 |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 130; Significance: 3e-67; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 44 - 192
Target Start/End: Complemental strand, 21834043 - 21833894
Alignment:
| Q |
44 |
agatctacatgattattgtcagctattgaacaatgaaaaagatgaatatattagaaatctggtaaaactgtattatgagcacaatttcagatgattcatt |
143 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
21834043 |
agatctacatgattattgtcagctattgaacaatgaaaaagatgaatatattagaaatatggtaaaactgcattatgagcacaatttcagatgattcatt |
21833944 |
T |
 |
| Q |
144 |
tcataatta-ttgtaattttaaaaagctggtaaaatcaatgaagcaagtg |
192 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
21833943 |
tcataattatttgtaattttaaaaagctggtaaaatcactgaagcaagtg |
21833894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 130; Significance: 3e-67; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 3e-67
Query Start/End: Original strand, 39 - 192
Target Start/End: Original strand, 22069092 - 22069245
Alignment:
| Q |
39 |
agagaagatctacatgattattgtcagctattgaacaatgaaaaagatgaatatattagaaatctggtaaaactgtattatgagcacaatttcagatgat |
138 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
22069092 |
agagaagatctacatgattattgtcagctattgaacgtagaaaaaaatgaatatattagaaatctggtaaaactgcattatgagcacaatttcagatgat |
22069191 |
T |
 |
| Q |
139 |
tcatttcataattattgtaattttaaaaagctggtaaaatcaatgaagcaagtg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22069192 |
tcatttcataattattgtaattttaaaaagctggtaaaatcactgaagcaagtg |
22069245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 270 - 347
Target Start/End: Original strand, 22069323 - 22069400
Alignment:
| Q |
270 |
gatttagaaataagcaggttgttgcagcttaaattttgatatactaaacattactatagatgagatatgaggaaaaaa |
347 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
22069323 |
gatttagaaataagcaggttgttgcagcttaaattttgatatactgaacattactatagatgagatatgagcaaaaaa |
22069400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0049 (Bit Score: 125; Significance: 3e-64; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 125; E-Value: 3e-64
Query Start/End: Original strand, 44 - 192
Target Start/End: Original strand, 13589 - 13737
Alignment:
| Q |
44 |
agatctacatgattattgtcagctattgaacaatgaaaaagatgaatatattagaaatctggtaaaactgtattatgagcacaatttcagatgattcatt |
143 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
13589 |
agatctacatgattattgttagctattgaacaatgaaaaagatgaatatattagaaatatggtaaaactgcattatgagcacaatttcagatgattcatt |
13688 |
T |
 |
| Q |
144 |
tcataattattgtaattttaaaaagctggtaaaatcaatgaagcaagtg |
192 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||| ||||||||||| |
|
|
| T |
13689 |
tcataattattgtaattttaaaaagtttgtaaaatcactgaagcaagtg |
13737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University