View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4579-Insertion-6 (Length: 339)
Name: NF4579-Insertion-6
Description: NF4579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4579-Insertion-6 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 300; Significance: 1e-169; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 300; E-Value: 1e-169
Query Start/End: Original strand, 8 - 339
Target Start/End: Original strand, 43788370 - 43788701
Alignment:
| Q |
8 |
gatacgtcgcgagttgtctattctgttgaaccgagagtcattcacgtcagtccctaaaacttcaaagacgttatccaacgcctcaccagcaaaccaccag |
107 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| | |||||||||| |
|
|
| T |
43788370 |
gatacgtcgcgagttgtctattctgttgaaccgagagtcattcacatcagtccctaaaacttcaaagacgttatccaacgcctcaccggtaaaccaccag |
43788469 |
T |
|
| Q |
108 |
ataacaaacaacctgcaaaagccggtgaagtatcaccggcggaaaggcttgcttccatttaaagaacaagccccaagaagaaacagagattttcttggaa |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43788470 |
ataacaaacaacctgcaaaagccggtgaagtatcaccagcggaaaggcttgcttccattcaaagaacaagccccaagaagaaacagagattttcttggaa |
43788569 |
T |
|
| Q |
208 |
tagagatcatgatatgatgcagatgttggatgaaggcgtgcaaatgggtcaagttcctggaatcttgttgccggactcgtctacattgccgccaatatcg |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43788570 |
tagagatcatgatatgatgcagatgttggatgaaggcgtgcaaatgggtcaagttcctggaatcttgttgtcggactcgtctacattgccgccaatatcg |
43788669 |
T |
|
| Q |
308 |
tcggagaatttttcactagtgccattgccgtc |
339 |
Q |
| |
|
||||| ||||||||||||||| |||||||||| |
|
|
| T |
43788670 |
tcggaaaatttttcactagtgtcattgccgtc |
43788701 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University