View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4579-Insertion-8 (Length: 195)
Name: NF4579-Insertion-8
Description: NF4579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4579-Insertion-8 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 6 - 195
Target Start/End: Complemental strand, 47501547 - 47501358
Alignment:
| Q |
6 |
caagtaaagcaccagctatcaaaatcaaagtaagaccagcgaaaacaccttgataaaataccattgtagcattaggaaaattccccaaaaatgctttccc |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47501547 |
caagtaaagcaccagctatcaaaatcaaagtaagaccagcgaaaacaccttgataaaataccattgtagcattaggaaaattccccaaaaatgctttccc |
47501448 |
T |
 |
| Q |
106 |
caacaaaaacttttcatctaatgctacatttggtttccctaagaaaaataccattttctccccaaatgacatttggtatgcccatgaaac |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47501447 |
caacaaaaacttttcatctaatgctacatttggtttccctaagaaaaataccattttctccccaaatgacatttggtatgcccatgaaac |
47501358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 13 - 84
Target Start/End: Original strand, 13350040 - 13350111
Alignment:
| Q |
13 |
agcaccagctatcaaaatcaaagtaagaccagcgaaaacaccttgataaaataccattgtagcattaggaaa |
84 |
Q |
| |
|
|||||||||||||||||||||||||| | |||| ||||||| |||| || | | ||| |||||||| ||||| |
|
|
| T |
13350040 |
agcaccagctatcaaaatcaaagtaatagcagcaaaaacacattgaaaataaatcatagtagcatttggaaa |
13350111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University