View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4579_low_2 (Length: 460)
Name: NF4579_low_2
Description: NF4579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4579_low_2 |
 | |
|
| [»] chr7 (3 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 212; Significance: 1e-116; HSPs: 3)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 178 - 460
Target Start/End: Original strand, 24767142 - 24767421
Alignment:
| Q |
178 |
ctttaagtttatatgcactgttttctatgacttttggataagcaaaggacgtgatttgttgatgcagatatgtcattgttgtatattcaacaaaatggaa |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
24767142 |
ctttaagtttatatgcactgttttctatgacttttggataagcaaaggacgtgatttgttgctgcagatatgtcattgttgtatattcagcaaaatggaa |
24767241 |
T |
|
| Q |
278 |
ataatagttgcaatctcaatatttttgtagtgatctgtatgttattatttaaattgtgtccggattttgaattctcaacactctctctcnnnnnnncttt |
377 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||| |||||||| |||| |
|
|
| T |
24767242 |
ataataattgcaatctcaatatttttgtagtgatccgtatgttattatttaaattgtgtccggattttgaattcgcaacattctctctctttttttcttt |
24767341 |
T |
|
| Q |
378 |
ggtgtagcacaacattctctcaatactatagaagacatgaaataataatatttgttgtaattctatagtttaataagataaat |
460 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
24767342 |
ggtgtagcgcaacattctctcaatactatagaagacatga---aataatatttgttgcaattctatagtttaaaaagataaat |
24767421 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 64; E-Value: 8e-28
Query Start/End: Original strand, 108 - 183
Target Start/End: Original strand, 24767039 - 24767114
Alignment:
| Q |
108 |
gttttgctgtttacttgatgtcgatgttagcagattcccatgcggtggtgaaaaagtttttctgcacaacctttaa |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
24767039 |
gttttgctgtttacttgatgtcgatgttagcagattctcatgcaatggtgaaaaagtttttctgcacaacctttaa |
24767114 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 3 - 39
Target Start/End: Original strand, 24766934 - 24766970
Alignment:
| Q |
3 |
ggagtaataatggttacattattgggaattgccctgt |
39 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
24766934 |
ggagtaataatggttacattattgggaattaccctgt |
24766970 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University