View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4580_low_3 (Length: 259)
Name: NF4580_low_3
Description: NF4580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4580_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 219; Significance: 1e-120; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 219; E-Value: 1e-120
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 41299891 - 41300113
Alignment:
| Q |
19 |
cacagagtccaatgttctataccagggaccaaattgaagaaccggttcagtactctcttttggatggtgaaggaacaaatattatgccatacaggaatct |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41299891 |
cacagagtccaatgttctataccagggaccaaattgaagaaccggttcagtactctcttttggatggtgaaggaacaaatattatgccatacaggaatct |
41299990 |
T |
|
| Q |
119 |
catggggacacaattgctacatgacttggcataatacatggcaaaggttgttgaattaatgttattaattttattgaagcttcagtcaaaaatattgaat |
218 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41299991 |
catggggacacaattgctacatgacttggcataatacatggcaaaggttgttgaattaatgttattaatttgattgaagcttcagtcaaaaatattgaat |
41300090 |
T |
|
| Q |
219 |
catgaaggtgcgtattcagatat |
241 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
41300091 |
catgaaggtgcgtattcagatat |
41300113 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University