View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4580_low_6 (Length: 202)

Name: NF4580_low_6
Description: NF4580
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4580_low_6
NF4580_low_6
[»] chr2 (7 HSPs)
chr2 (19-202)||(17596029-17596212)
chr2 (42-179)||(10194080-10194217)
chr2 (43-200)||(22564637-22564794)
chr2 (42-201)||(24185544-24185703)
chr2 (88-198)||(34427077-34427187)
chr2 (134-201)||(22379373-22379440)
chr2 (134-201)||(27608049-27608116)
[»] chr7 (3 HSPs)
chr7 (42-181)||(37246977-37247116)
chr7 (42-201)||(10012748-10012907)
chr7 (43-202)||(45088595-45088753)
[»] chr8 (1 HSPs)
chr8 (42-170)||(12658260-12658388)
[»] chr4 (3 HSPs)
chr4 (68-201)||(43096163-43096296)
chr4 (42-201)||(9047460-9047619)
chr4 (130-179)||(29961921-29961970)
[»] chr1 (3 HSPs)
chr1 (68-201)||(45992318-45992451)
chr1 (42-201)||(19280630-19280789)
chr1 (134-201)||(12213151-12213218)
[»] scaffold0126 (1 HSPs)
scaffold0126 (42-201)||(43862-44021)
[»] chr3 (2 HSPs)
chr3 (68-179)||(22721198-22721309)
chr3 (42-201)||(14960266-14960424)
[»] scaffold0664 (1 HSPs)
scaffold0664 (42-201)||(2048-2207)
[»] chr5 (2 HSPs)
chr5 (42-168)||(21747419-21747545)
chr5 (134-167)||(4151791-4151824)
[»] scaffold0301 (1 HSPs)
scaffold0301 (134-202)||(4934-5002)


Alignment Details
Target: chr2 (Bit Score: 168; Significance: 3e-90; HSPs: 7)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 19 - 202
Target Start/End: Complemental strand, 17596212 - 17596029
Alignment:
Q  19 taattttcacgtcatttcatgtcatatgaggttttttgtgtctcacttttatagagaaggtaatgcttctgctgatggctttgcaaacctaggtctttct 118  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  17596212 taattttcacgtcatttcatgtcatatgaggttttttgtgtctcacttttatagagaaggtaatgcatctgctgatggctttgcaaacctaggtctttct 17596113  T
Q  119 ttgttatcctctgagttattttggtcagatattatccctgatttcattagggtagattacactggaaataagttgggaatgcct 202  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||    
T  17596112 ttgttatcctctgagttattttagtcagatattatccctgatttcattagaatagattacactggaaataagttgggaatgcct 17596029  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 42 - 179
Target Start/End: Complemental strand, 10194217 - 10194080
Alignment:
Q  42 atatgaggttttttgtgtctcacttttatagagaaggtaatgcttctgctgatggctttgcaaacctaggtctttctttgttatcctctgagttattttg 141  Q
    ||||||||||| ||||||||||| ||||||||||||||||||| | ||||||| |  |||||||||||| ||||||||||| ||| | ||||||||||||    
T  10194217 atatgaggtttgttgtgtctcacatttatagagaaggtaatgcatgtgctgatagtcttgcaaacctagatctttctttgtcatcttttgagttattttg 10194118  T
Q  142 gtcagatattatccctgatttcattagggtagattaca 179  Q
    ||| |||| |||||||||||||||||||| ||| ||||    
T  10194117 gtctgatactatccctgatttcattaggggagagtaca 10194080  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 43 - 200
Target Start/End: Original strand, 22564637 - 22564794
Alignment:
Q  43 tatgaggttttttgtgtctcacttttatagagaaggtaatgcttctgctgatggctttgcaaacctaggtctttctttgttatcctctgagttattttgg 142  Q
    |||||||||| | ||||||||| ||||||||||||| |||| || ||||||  || |||| || || ||||| ||| |||  || |||||| | ||||||    
T  22564637 tatgaggtttgtggtgtctcacatttatagagaagggaatgtttgtgctgacagccttgcgaatcttggtctctctatgtcttcttctgaggtgttttgg 22564736  T
Q  143 tcagatattatccctgatttcattagggtagattacactggaaataagttgggaatgc 200  Q
    |||||| |||  |||||||||||||| | ||| |||||| | |||| |||||||||||    
T  22564737 tcagattttactcctgatttcattagtggagagtacactaggaataggttgggaatgc 22564794  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 42 - 201
Target Start/End: Complemental strand, 24185703 - 24185544
Alignment:
Q  42 atatgaggttttttgtgtctcacttttatagagaaggtaatgcttctgctgatggctttgcaaacctaggtctttctttgttatcctctgagttattttg 141  Q
    ||||||| ||| | ||||| ||| | ||||| ||||| |||| || ||||||| || |||||||| | || || ||||| |  || | ||| ||||||||    
T  24185703 atatgagatttgtggtgtcacacatatatagggaagggaatgtttgtgctgatagccttgcaaacatgggcctctctttctcttcttttgatttattttg 24185604  T
Q  142 gtcagatattatccctgatttcattagggtagattacactggaaataagttgggaatgcc 201  Q
    ||||||||||||||||||||| ||||||| ||| |||| | | |||| |||||| |||||    
T  24185603 gtcagatattatccctgattttattaggggagagtacattaggaataggttgggtatgcc 24185544  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 88 - 198
Target Start/End: Complemental strand, 34427187 - 34427077
Alignment:
Q  88 tgctgatggctttgcaaacctaggtctttctttgttatcctctgagttattttggtcagatattatccctgatttcattagggtagattacactggaaat 187  Q
    ||||||| || |||||||||||  ||||||||| | |||   ||||||||||||||| |||| ||||||||||||||||| || ||| |||| | | |||    
T  34427187 tgctgatagccttgcaaacctacatctttctttatcatctcttgagttattttggtctgatactatccctgatttcattaagggagagtacaataggaat 34427088  T
Q  188 aagttgggaat 198  Q
    | |||||||||    
T  34427087 aggttgggaat 34427077  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 134 - 201
Target Start/End: Complemental strand, 22379440 - 22379373
Alignment:
Q  134 ttattttggtcagatattatccctgatttcattagggtagattacactggaaataagttgggaatgcc 201  Q
    ||||||||||| |||| | |||||||||||||||||| ||| |||||| | |||| ||||||||||||    
T  22379440 ttattttggtctgatagtgtccctgatttcattaggggagagtacactaggaataggttgggaatgcc 22379373  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #7
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 134 - 201
Target Start/End: Original strand, 27608049 - 27608116
Alignment:
Q  134 ttattttggtcagatattatccctgatttcattagggtagattacactggaaataagttgggaatgcc 201  Q
    ||||||||||| |||| | |||||||||||||||||| ||| |||||| | |||| | ||||||||||    
T  27608049 ttattttggtctgatagtgtccctgatttcattaggggagagtacactaggaataggctgggaatgcc 27608116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 80; Significance: 1e-37; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 42 - 181
Target Start/End: Original strand, 37246977 - 37247116
Alignment:
Q  42 atatgaggttttttgtgtctcacttttatagagaaggtaatgcttctgctgatggctttgcaaacctaggtctttctttgttatcctctgagttattttg 141  Q
    ||||||||||||||||||| ||  |||||||||||||||||| || ||| |||||| ||||||||||||||||| |||||   |||||||| ||||||||    
T  37246977 atatgaggttttttgtgtcccatatttatagagaaggtaatgtttgtgcagatggccttgcaaacctaggtcttactttgccttcctctgaattattttg 37247076  T
Q  142 gtcagatattatccctgatttcattagggtagattacact 181  Q
    |||||||||||||| |||||||||||||| ||| ||||||    
T  37247077 gtcagatattatccttgatttcattaggggagaatacact 37247116  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 42 - 201
Target Start/End: Original strand, 10012748 - 10012907
Alignment:
Q  42 atatgaggttttttgtgtctcacttttatagagaaggtaatgcttctgctgatggctttgcaaacctaggtctttctttgttatcctctgagttattttg 141  Q
    ||||||| ||| | ||||| ||| | ||||| ||||| ||||||| ||||||| || |||||||||| || || ||||  |  || | ||| ||||||||    
T  10012748 atatgagatttgtggtgtcacacatatatagggaagggaatgcttgtgctgatagccttgcaaacctgggcctctcttactcttcttttgatttattttg 10012847  T
Q  142 gtcagatattatccctgatttcattagggtagattacactggaaataagttgggaatgcc 201  Q
    ||||||||||||||||||||| ||||||| ||| |||| | | |||| |||||| |||||    
T  10012848 gtcagatattatccctgattttattaggggagagtacattaggaataggttgggtatgcc 10012907  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 43 - 202
Target Start/End: Original strand, 45088595 - 45088753
Alignment:
Q  43 tatgaggttttttgtgtctcacttttatagagaaggtaatgcttctgctgatggctttgcaaacctaggtctttctttgttatcctctgagttattttgg 142  Q
    |||||| |||||||| || ||| | ||||| ||||| |||| || ||||||| |||| ||||||||  |||||||||| |  || | | |||||||||||    
T  45088595 tatgagattttttgtatcacacatctatagggaagggaatgtttgtgctgatagctt-gcaaacctgagtctttctttttcttcttttcagttattttgg 45088693  T
Q  143 tcagatattatccctgatttcattagggtagattacactggaaataagttgggaatgcct 202  Q
     | ||||||||| |||||||||||| || ||| |||| | |||||| |||||| ||||||    
T  45088694 actgatattatctctgatttcattacgggagagtacatttgaaataggttgggtatgcct 45088753  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 65; Significance: 9e-29; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 65; E-Value: 9e-29
Query Start/End: Original strand, 42 - 170
Target Start/End: Complemental strand, 12658388 - 12658260
Alignment:
Q  42 atatgaggttttttgtgtctcacttttatagagaaggtaatgcttctgctgatggctttgcaaacctaggtctttctttgttatcctctgagttattttg 141  Q
    ||||||| ||||||||||| ||  ||||||||||||||||||||| |||  ||||| ||||||||||||||||| |||||   |||||||| ||||||||    
T  12658388 atatgagattttttgtgtcccatatttatagagaaggtaatgcttatgcaaatggccttgcaaacctaggtcttactttgccttcctctgaattattttg 12658289  T
Q  142 gtcagatattatccctgatttcattaggg 170  Q
    |||||||||||||  | ||||||||||||    
T  12658288 gtcagatattatctttaatttcattaggg 12658260  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 58; Significance: 1e-24; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 58; E-Value: 1e-24
Query Start/End: Original strand, 68 - 201
Target Start/End: Complemental strand, 43096296 - 43096163
Alignment:
Q  68 tatagagaaggtaatgcttctgctgatggctttgcaaacctaggtctttctttgttatcctctgagttattttggtcagatattatccctgatttcatta 167  Q
    ||||||||||| ||||||| ||||||| || |||||||||||||||| |||||    || | ||| ||||||||||||||||||||||||||||||||||    
T  43096296 tatagagaagggaatgcttgtgctgatagccttgcaaacctaggtctctctttcacttcttttgatttattttggtcagatattatccctgatttcatta 43096197  T
Q  168 gggtagattacactggaaataagttgggaatgcc 201  Q
    ||| ||| ||||   |||||| |||||| |||||    
T  43096196 ggggagagtacatcagaaataggttgggtatgcc 43096163  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 42 - 201
Target Start/End: Complemental strand, 9047619 - 9047460
Alignment:
Q  42 atatgaggttttttgtgtctcacttttatagagaaggtaatgcttctgctgatggctttgcaaacctaggtctttctttgttatcctctgagttattttg 141  Q
    ||||||||||| | |||||||||  |||||||||||| ||||||| ||||||  || |||| || || ||||| ||| |||  || |||||| | |||||    
T  9047619 atatgaggtttgtggtgtctcacaattatagagaagggaatgcttgtgctgacagccttgcgaatcttggtctctctatgtcttcttctgaggtgttttg 9047520  T
Q  142 gtcagatattatccctgatttcattagggtagattacactggaaataagttgggaatgcc 201  Q
    |||||||  ||  |||||||||||||| | ||| |||||| | |||| |||| |||||||    
T  9047519 gtcagattatactcctgatttcattagaggagagtacactaggaataggttgagaatgcc 9047460  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 130 - 179
Target Start/End: Complemental strand, 29961970 - 29961921
Alignment:
Q  130 tgagttattttggtcagatattatccctgatttcattagggtagattaca 179  Q
    ||||||||||||||| |||| |||||||||||| ||||||| ||| ||||    
T  29961970 tgagttattttggtctgatagtatccctgatttaattaggggagagtaca 29961921  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 50; Significance: 8e-20; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 68 - 201
Target Start/End: Original strand, 45992318 - 45992451
Alignment:
Q  68 tatagagaaggtaatgcttctgctgatggctttgcaaacctaggtctttctttgttatcctctgagttattttggtcagatattatccctgatttcatta 167  Q
    ||||||||||| ||||||| ||||||| || |||||||||||||||| |||||    || |   | ||||||||||||||||||||||||||||||||||    
T  45992318 tatagagaagggaatgcttgtgctgatagccttgcaaacctaggtctctctttcacttctttaaatttattttggtcagatattatccctgatttcatta 45992417  T
Q  168 gggtagattacactggaaataagttgggaatgcc 201  Q
    ||| ||| ||||   | ||||||||||| |||||    
T  45992418 ggggagagtacatcaggaataagttgggtatgcc 45992451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 201
Target Start/End: Complemental strand, 19280789 - 19280630
Alignment:
Q  42 atatgaggttttttgtgtctcacttttatagagaaggtaatgcttctgctgatggctttgcaaacctaggtctttctttgttatcctctgagttattttg 141  Q
    ||||||| ||| | ||||| ||| | ||||| ||||  ||||||| ||||||| || |||||||||| | ||| |||||    || | ||| ||||||||    
T  19280789 atatgagatttgtggtgtcacacatatatagggaagagaatgcttgtgctgatagccttgcaaaccttgatctctctttcacttcttttgatttattttg 19280690  T
Q  142 gtcagatattatccctgatttcattagggtagattacactggaaataagttgggaatgcc 201  Q
    |||||||| |||||||||||| ||||||| ||| |||| | | |||| |||||| |||||    
T  19280689 gtcagatactatccctgattttattaggggagagtacattaggaatatgttgggtatgcc 19280630  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 134 - 201
Target Start/End: Original strand, 12213151 - 12213218
Alignment:
Q  134 ttattttggtcagatattatccctgatttcattagggtagattacactggaaataagttgggaatgcc 201  Q
    |||||||||||||||||||||| |||||| ||||||| ||| |||| | | |||| |||||| |||||    
T  12213151 ttattttggtcagatattatccatgattttattaggggagagtacattaggaatatgttgggtatgcc 12213218  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0126 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: scaffold0126
Description:

Target: scaffold0126; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 42 - 201
Target Start/End: Original strand, 43862 - 44021
Alignment:
Q  42 atatgaggttttttgtgtctcacttttatagagaaggtaatgcttctgctgatggctttgcaaacctaggtctttctttgttatcctctgagttattttg 141  Q
    ||||||| ||| | ||||| ||| | ||||| ||||| ||||||| ||||||| || |||||||||| || || ||||| |  || | ||| ||||||||    
T  43862 atatgagatttgtggtgtcacacatatatagggaagggaatgcttgtgctgatagccttgcaaacctgggcctctctttctcttcttttgatttattttg 43961  T
Q  142 gtcagatattatccctgatttcattagggtagattacactggaaataagttgggaatgcc 201  Q
    ||||||||||||||||||||| ||||||| ||| |||| | | |||| |||||| |||||    
T  43962 gtcagatattatccctgattttattaggggagagtacattaggaataggttgggtatgcc 44021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 48; Significance: 1e-18; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 68 - 179
Target Start/End: Complemental strand, 22721309 - 22721198
Alignment:
Q  68 tatagagaaggtaatgcttctgctgatggctttgcaaacctaggtctttctttgttatcctctgagttattttggtcagatattatccctgatttcatta 167  Q
    ||||||||||| ||||||| ||||||| || ||||||| |||||||| |||||    || | ||| |||||||||||||||||||||||||||||||| |    
T  22721309 tatagagaagggaatgcttgtgctgatagccttgcaaatctaggtctctctttcacttcttttgatttattttggtcagatattatccctgatttcataa 22721210  T
Q  168 gggtagattaca 179  Q
    ||| ||| ||||    
T  22721209 ggggagagtaca 22721198  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 42 - 201
Target Start/End: Original strand, 14960266 - 14960424
Alignment:
Q  42 atatgaggttttttgtgtctcacttttatagagaaggtaatgcttctgctgatggctttgcaaacctaggtctttctttgttatcctctgagttattttg 141  Q
    ||||||| ||| | ||||| ||| | ||||| ||||| ||||||| ||||||| || |||||||||| || || ||||| |  || | ||| ||||||||    
T  14960266 atatgagatttatggtgtcacacatatatagggaagggaatgcttgtgctgatagccttgcaaacctgggcctctctttctcttcttttgatttattttg 14960365  T
Q  142 gtcagatattatccctgatttcattagggtagattacactggaaataagttgggaatgcc 201  Q
    |||||||||||| || ||||| ||||||| ||| |||| | | |||| |||||| |||||    
T  14960366 gtcagatattat-ccagattttattaggggagagtacattaggaataggttgggtatgcc 14960424  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0664 (Bit Score: 40; Significance: 0.00000000000007; HSPs: 1)
Name: scaffold0664
Description:

Target: scaffold0664; HSP #1
Raw Score: 40; E-Value: 0.00000000000007
Query Start/End: Original strand, 42 - 201
Target Start/End: Original strand, 2048 - 2207
Alignment:
Q  42 atatgaggttttttgtgtctcacttttatagagaaggtaatgcttctgctgatggctttgcaaacctaggtctttctttgttatcctctgagttattttg 141  Q
    ||||||| ||| | ||||| ||| | ||||| ||||| ||||||| ||||||| || |||||||| | || || ||||  |  || | ||| ||||||||    
T  2048 atatgagatttgtggtgtcacacatatatagggaagggaatgcttgtgctgatagccttgcaaacatgggcctctcttactcttcttttgatttattttg 2147  T
Q  142 gtcagatattatccctgatttcattagggtagattacactggaaataagttgggaatgcc 201  Q
    ||||||||||||||||||||| ||||||| ||| |||| | | |||| |||||| |||||    
T  2148 gtcagatattatccctgattttattaggggagagtacattaggaataggttgggtatgcc 2207  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 42 - 168
Target Start/End: Original strand, 21747419 - 21747545
Alignment:
Q  42 atatgaggttttttgtgtctcacttttatagagaaggtaatgcttctgctgatggctttgcaaacctaggtctttctttgttatcctctgagttattttg 141  Q
    ||||||||||| | ||||||||| ||||||||||||| ||||||| ||||||  || |||| || || ||||| ||| |||  || |||||| | |||||    
T  21747419 atatgaggtttgtggtgtctcacatttatagagaagggaatgcttgtgctgacagccttgcgaatcttggtctctctatgtcttcttctgaggtgttttg 21747518  T
Q  142 gtcagatattatccctgatttcattag 168  Q
    |||||||  ||  ||||||||||||||    
T  21747519 gtcagattatactcctgatttcattag 21747545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 134 - 167
Target Start/End: Original strand, 4151791 - 4151824
Alignment:
Q  134 ttattttggtcagatattatccctgatttcatta 167  Q
    |||||||||||||||||||||| |||||||||||    
T  4151791 ttattttggtcagatattatccttgatttcatta 4151824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0301 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0301
Description:

Target: scaffold0301; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 134 - 202
Target Start/End: Complemental strand, 5002 - 4934
Alignment:
Q  134 ttattttggtcagatattatccctgatttcattagggtagattacactggaaataagttgggaatgcct 202  Q
    ||||||||||| |||| | |||||||||||||||||| ||| |||||| | |||| | |||||||||||    
T  5002 ttattttggtctgatagtgtccctgatttcattaggggagagtacactaggaataggctgggaatgcct 4934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University