View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4581-Insertion-11 (Length: 299)
Name: NF4581-Insertion-11
Description: NF4581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4581-Insertion-11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 8 - 298
Target Start/End: Original strand, 22148983 - 22149274
Alignment:
| Q |
8 |
gctttatgctgtgaaaagctgaaaaacaagtttgaagagctaaatggatttaactttgagcta-aagtttatataatgatggaagccctaagattgggtt |
106 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
22148983 |
gctttatgttgttaaaagctgaaaaacaagtttgaagagctaaatggatttaactttgagctataagtttatataatgatggaagccctaagattgggtt |
22149082 |
T |
 |
| Q |
107 |
aaacctcttttcttgtattgtacacccaaataaatatatgtaatctttctaatgatttcattatggaaatctggatttgattcctggtgattctacatga |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22149083 |
aaacctcttttcttgtattgtacacccaaataaatatatgtaatctttctaatgatttcattatggaaatctggatttgattcctggtgattctacatga |
22149182 |
T |
 |
| Q |
207 |
tcatattttagttaggaaaagattatctggtgtattctgttgatatttttcagcgggtcttgcctaaatggaaaccattgaaagtattgtgt |
298 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
22149183 |
tcatattttagtttggaaaagattatctggtgtattctgttgatatttttcagcgggtcttgcctaaatggaaaccattgaaattattgtgt |
22149274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University