View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4582_high_3 (Length: 442)
Name: NF4582_high_3
Description: NF4582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4582_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 214; Significance: 1e-117; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 127 - 425
Target Start/End: Complemental strand, 34839020 - 34838721
Alignment:
| Q |
127 |
tttagaaatttgataaatttctaaaaattgtataatgcactatcatccctgtaatgcatgtgtgcaaagtgtgcagtgtgctagctattgtgtaggctta |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34839020 |
tttagaaatttgataaatttctaaaaattgtataatgcactatcatccctgtaatgcatgtgtgcaaagtgtgcagtgtgctagctattgtgtaggctta |
34838921 |
T |
 |
| Q |
227 |
ggtgtttttgctaaaactaaggtctaattgtgaaggatataataaagaca-nnnnnnngtttaaccctttggtttttagaggaagggaccccaataattc |
325 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34838920 |
ggtgtttttgctaaaactaaggtttaattgtgaaggatataataaagacattttttttgtttaaccctttggtttttagaggaagggacctcaataattt |
34838821 |
T |
 |
| Q |
326 |
gaattttggtcagaacatgaattgaaaatgaagnnnnnnnaattaaatacgttgaacttgaactatctttgtagttcggttcgtttgattcatatgttaa |
425 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||| |||||||||||||||||||||||||| ||| |||||||||||| ||||||||||| |||| |
|
|
| T |
34838820 |
gaattttggtcaaaacttgaattgaaaatgaagtttttttaattaaatacgttgaacttgaactatttttatagttcggttcgcttgattcatattttaa |
34838721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 285 - 316
Target Start/End: Complemental strand, 34834718 - 34834687
Alignment:
| Q |
285 |
tttaaccctttggtttttagaggaagggaccc |
316 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
34834718 |
tttaaccctttggtttttagaggaagggaccc |
34834687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 369 - 423
Target Start/End: Complemental strand, 34840895 - 34840841
Alignment:
| Q |
369 |
taaatacgttgaacttgaactatctttgtagttcggttcgtttgattcatatgtt |
423 |
Q |
| |
|
||||||||||||| ||||||||||| | ||||| || ||| |||||||||||||| |
|
|
| T |
34840895 |
taaatacgttgaatttgaactatctatatagtttggctcgcttgattcatatgtt |
34840841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University