View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4582_high_8 (Length: 377)
Name: NF4582_high_8
Description: NF4582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4582_high_8 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 19 - 266
Target Start/End: Original strand, 31646718 - 31646966
Alignment:
| Q |
19 |
tacattatttattattgatgtatttattacaaatttgaaataccagtcaaatgacaattcttttacattatactagattgattttttgtcttttgctaaa |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
31646718 |
tacattatttattattgatgtatttattacaaatttgaaataccagtcaaatgacaattattttacattatactaaattgattttttgtcttttgctaaa |
31646817 |
T |
|
| Q |
119 |
ttaaggtaatctttccacgaaactacatagacgtaattgtaatttgattaagaagttaatctctctca--atatggttgacacatgatgaacttttgacn |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| ||||||| |
|
|
| T |
31646818 |
ttaaggtaatctttccacgaaactacatagacgtaattgtaatttgattaagaagttaatctctctcaacatatggttgacacatgatgaatttttgac- |
31646916 |
T |
|
| Q |
217 |
nnnnnnttgcatagactgatgtataatttatttatggaattaatcgtctc |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31646917 |
aaaaaattgcatagactgatgtataatttatttatggaattaatcgtctc |
31646966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University