View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4582_low_12 (Length: 277)
Name: NF4582_low_12
Description: NF4582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4582_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 20 - 269
Target Start/End: Original strand, 54852118 - 54852364
Alignment:
| Q |
20 |
tgggcgatagagtgaattgaattttcagcacaatttgatttgtggtattttgtatcaagtaatcttgtggactnnnnnnntttacagtgtggttgtgcgg |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
54852118 |
tgggcgatagagtgaattgaattttcagcacaatttgatttgtggtattttgtatcaagtaatcctgtggactgggggggtttacagtgtggttgtgcgg |
54852217 |
T |
 |
| Q |
120 |
cttcttgtggactgtgtatatagtctacaggttttgtgcgctgtttcttggttgggatagcactatttctgcttttgctgtctcggttgggcaatagtcg |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54852218 |
cttcttgtggactgtgtatatagtctacaggttttgtgcgctgtttctt---tgggatagcactatttctgcttttgctgtctcggttgggcaatagtcg |
54852314 |
T |
 |
| Q |
220 |
gatagttccgctgtggatatgtatagcatactttgtatttagtgatgatg |
269 |
Q |
| |
|
||||||||||| |||||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
54852315 |
gatagttccgccgtggatatgtgtagcatactttgtatttagtggtgatg |
54852364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University