View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4582_low_15 (Length: 252)
Name: NF4582_low_15
Description: NF4582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4582_low_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 84; Significance: 5e-40; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 151 - 242
Target Start/End: Original strand, 44624137 - 44624228
Alignment:
| Q |
151 |
accagttgttttttcagggaagaagaagccctcaaagggttcgaagaaaggggcaagtagtttgttcagtgcattagatgagaatgatgatg |
242 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44624137 |
accagttgttttttcggggaagaagaagccctcaaagggttggaagaaaggggcaagtagtttgttcagtgcattagatgagaatgatgatg |
44624228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 17 - 93
Target Start/End: Original strand, 44624003 - 44624079
Alignment:
| Q |
17 |
aagaagaaatcctcgaagggttctaagaaaggtggtggtggaagtgtgtttacggctgccgctggttttggtttgct |
93 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44624003 |
aagaagaaatcctcgaagggttctaagaaaggtggtggtggaagtgtgtttacggctgcggctggttttggtttgct |
44624079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University