View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4582_low_16 (Length: 250)
Name: NF4582_low_16
Description: NF4582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4582_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 148; Significance: 3e-78; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 148; E-Value: 3e-78
Query Start/End: Original strand, 1 - 156
Target Start/End: Original strand, 51351488 - 51351643
Alignment:
| Q |
1 |
ttcactgtttagttgatacataatttcactttaaattcagtgttacaaaatctattcaattcaaaattatatttgacgaatactcactcaaacataattg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51351488 |
ttcactgtttagttgatacataatttcactttaaattcagggttacaaaatctattcaattcaaaattatatttgacgaataatcactcaaacataattg |
51351587 |
T |
 |
| Q |
101 |
agtgtgaagtgaagtgacaatgtttttatgttaaaagctaaaagcgttcattttcc |
156 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51351588 |
agtgtgaagtgaagtgacaatgtttttatgttaaaagctaaaagcgttcattttcc |
51351643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 171 - 243
Target Start/End: Original strand, 51351901 - 51351972
Alignment:
| Q |
171 |
ttgggaaaaaatgtttgttacttgtttgtgtgcatgtttcgagtgtttgttcaagtctcatgctttcttctct |
243 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51351901 |
ttgggaaaaaatgtt-gttacttgtttgtgtgcatgtttcgagtgtttgttcaagtctcatgctttcttctct |
51351972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University