View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4582_low_8 (Length: 390)

Name: NF4582_low_8
Description: NF4582
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4582_low_8
NF4582_low_8
[»] chr3 (7 HSPs)
chr3 (102-320)||(44789326-44789549)
chr3 (142-237)||(44792961-44793056)
chr3 (142-231)||(44797855-44797944)
chr3 (147-231)||(44801250-44801334)
chr3 (322-372)||(44789240-44789290)
chr3 (142-231)||(44805742-44805831)
chr3 (331-368)||(44792182-44792219)


Alignment Details
Target: chr3 (Bit Score: 158; Significance: 6e-84; HSPs: 7)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 158; E-Value: 6e-84
Query Start/End: Original strand, 102 - 320
Target Start/End: Complemental strand, 44789549 - 44789326
Alignment:
102 tcaaagctagtagttaaatttactaaagagtttgtcttagatctaatcttgcgtggcctacgattggatctcattaagcctggtcgtgtcctcttctc-a 200  Q
    ||||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
44789549 tcaaagctaatagataaatttactcaagagtttgtcttagatctaatcttgcgtggcctacgattggatctcattaagcctggtcgtgtcctcttctcaa 44789450  T
201 atgagcataccctcacgtttactcgttcgtatcctacct--tctcttcatcttcctctttccctg--atatattannnnnnnnagtacctaaattaattg 296  Q
    |||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||||  ||||||||        |||||||||||||||||    
44789449 atgagcataccctcacgtttactcgttcgtatcctacctactctcttcatcttcctctttccctgatatatattattttttttagtacctaaattaattg 44789350  T
297 attaatttgcagaattcaggtaag 320  Q
    ||||||||||||||||||||||||    
44789349 attaatttgcagaattcaggtaag 44789326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 60; E-Value: 2e-25
Query Start/End: Original strand, 142 - 237
Target Start/End: Complemental strand, 44793056 - 44792961
Alignment:
142 atctaatcttgcgtggcctacgattggatctcattaagcctggtcgtgtcctcttctcaatgagcataccctcacgtttactcgttcgtatcctac 237  Q
    |||||| |||||| |||||||||||||||| |||| | |||||||||||| |||||||||||| ||||||  ||||||||||||||||||||||||    
44793056 atctaaccttgcgcggcctacgattggatcgcattgaacctggtcgtgtcgtcttctcaatgaacatacctccacgtttactcgttcgtatcctac 44792961  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 142 - 231
Target Start/End: Complemental strand, 44797944 - 44797855
Alignment:
142 atctaatcttgcgtggcctacgattggatctcattaagcctggtcgtgtcctcttctcaatgagcataccctcacgtttactcgttcgta 231  Q
    ||||||||||||| | ||| ||||||||||||||| | |||||||||||| |||||||||||| ||||||| ||||||||||||||||||    
44797944 atctaatcttgcgcgccctgcgattggatctcattgaacctggtcgtgtcgtcttctcaatgaacatacccccacgtttactcgttcgta 44797855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 147 - 231
Target Start/End: Complemental strand, 44801334 - 44801250
Alignment:
147 atcttgcgtggcctacgattggatctcattaagcctggtcgtgtcctcttctcaatgagcataccctcacgtttactcgttcgta 231  Q
    |||||||||||||||||||||||||||||| ||||||| | |||| | |||||||||| ||||||  ||||||||||||||||||    
44801334 atcttgcgtggcctacgattggatctcattgagcctggccatgtcgttttctcaatgaacatacctccacgtttactcgttcgta 44801250  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #5
Raw Score: 51; E-Value: 4e-20
Query Start/End: Original strand, 322 - 372
Target Start/End: Complemental strand, 44789290 - 44789240
Alignment:
322 tggatgtgataggcgcagctgcaattcccgccgctggatttccgtgggagt 372  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||    
44789290 tggatgtgataggcgcagctgcaattcccgccgctggatttccgtgggagt 44789240  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #6
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 142 - 231
Target Start/End: Complemental strand, 44805831 - 44805742
Alignment:
142 atctaatcttgcgtggcctacgattggatctcattaagcctggtcgtgtcctcttctcaatgagcataccctcacgtttactcgttcgta 231  Q
    |||||||||||||||||||||| || ||| ||||| ||||||| |||||| | ||| |||||| ||||||| ||||||||||||||||||    
44805831 atctaatcttgcgtggcctacgcttcgatgtcattgagcctggccgtgtcattttcacaatgaacatacccccacgtttactcgttcgta 44805742  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 331 - 368
Target Start/End: Complemental strand, 44792219 - 44792182
Alignment:
331 taggcgcagctgcaattcccgccgctggatttccgtgg 368  Q
    |||||||||| ||||||||||| |||||||||||||||    
44792219 taggcgcagccgcaattcccgcagctggatttccgtgg 44792182  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University