View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4583_low_5 (Length: 286)
Name: NF4583_low_5
Description: NF4583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4583_low_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 110 - 274
Target Start/End: Original strand, 27056116 - 27056281
Alignment:
| Q |
110 |
gcctcaacatgtcggatacc-tttgtagcgtttgtcaatttccactctctaaatttgttgtctctcccaatcttgccaagctcgaccaacatttggcctc |
208 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27056116 |
gcctcaacatgtcggataccctttgtagcgtttgtcaatttccactctctaaatttgttgtctctcccaatcttgccaagcttgaccaacatttggcctc |
27056215 |
T |
 |
| Q |
209 |
atgcaaagcattaattacaattgattagaagatctggagatgcattttacttttatttgatgatgt |
274 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27056216 |
atgcaaagcattaattacaattgattagaagatctggagatgcattttacttttatttgttgatgt |
27056281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University