View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4583_low_6 (Length: 263)
Name: NF4583_low_6
Description: NF4583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4583_low_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 11 - 246
Target Start/End: Complemental strand, 42685252 - 42685017
Alignment:
| Q |
11 |
cagagataagagagtagaggaacaaaaacactaatataatactattatttcccagtttggcttaaactgaccttcgtctgcggggagaatagctctccaa |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42685252 |
cagagataagagagtagaggaacaaaaacactaatataatactattatttcccagtttgccttaaattgaccttcgtctgcggggagaatagctctccaa |
42685153 |
T |
|
| Q |
111 |
accactacgagtgagtccttacaggggatgtaaagaggctacaagtaattaacttcaacgataaaccataatttccacccttttctcaagtctatcttag |
210 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42685152 |
accactacgagtgagtccttacagggaatgtaaagaggttacaagtaattaacttcaacgataaaccataatttccacccttttctcaagtctatcttag |
42685053 |
T |
|
| Q |
211 |
tccacaacaagatcctaagaaaatcaagagagaaag |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
42685052 |
tccacaacaagatcctaagaaaatcaagagagaaag |
42685017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University