View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4584_low_2 (Length: 238)
Name: NF4584_low_2
Description: NF4584
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4584_low_2 |
 | |
|
| [»] scaffold0001 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 32569949 - 32570170
Alignment:
| Q |
1 |
tcaatgacatgccccactaattaaatttatcattgtaatgaacatatccatatgaaatatgattaaaatagttaaaatatcatacagagaaaacaattat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32569949 |
tcaatgacatgccccactaattaaatttatcattgtaatgaacatatccatatgaaatatgattaaaatagttaaaatatcatacagagaaaacaattat |
32570048 |
T |
|
| Q |
101 |
ttagaacctttctattccacaaacaaaatagtttaaggcctgttcacaaacaaaattatttagaaccttcctattccacaaacaaaataattctttcttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
32570049 |
ttagaacctttctattccacaaacaaaatagtttaaggcctgttcacaaacaaaattatttagaacctttctattccacaaacaaaataattctttcttt |
32570148 |
T |
|
| Q |
201 |
tacaaattttgataagagatct |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
32570149 |
tacaaattttgataagagatct |
32570170 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 25 - 96
Target Start/End: Complemental strand, 4132 - 4061
Alignment:
| Q |
25 |
atttatcattgtaatgaacatatccatatgaaatatgattaaaatagttaaaatatcatacagagaaaacaa |
96 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
4132 |
atttatcattgtaatgaacatatccgtatgaaatatgattaaaatagttaaaatatcatacatagaagacaa |
4061 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University