View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4585_high_7 (Length: 253)
Name: NF4585_high_7
Description: NF4585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4585_high_7 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 233
Target Start/End: Original strand, 54847967 - 54848211
Alignment:
| Q |
1 |
ttataatttttctcttaagctgaacaaatggaacaagaaatcgaaaacatgatattcaacatgagttcacttggaacaagtttctcacaaaagtaagagc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54847967 |
ttataatttttctcttaagctgaacaaatggaagaagaaatcgaaaacatgatattcaacatgagttcacttggaacaagtttctcacaaaagtaagagc |
54848066 |
T |
 |
| Q |
101 |
atttaattgtttgt------------ttaattaattttgcttgattaaattttgtgttatatgtatgagcaggagaggaggattatcaaggtattactca |
188 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54848067 |
atttaattgtttgtttaattaattaattaattaattttgcttgattaaattttgtgttatatgtatgagcaggagaggaggattatcaaggtattactca |
54848166 |
T |
 |
| Q |
189 |
gggaaagcaagatcatttgtttgtatggaagatgtacattcggtt |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54848167 |
gggaaagcaagatcatttgtttgtatggaagatgtacattcggtt |
54848211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University