View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4585_low_10 (Length: 249)
Name: NF4585_low_10
Description: NF4585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4585_low_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 18 - 210
Target Start/End: Complemental strand, 18018710 - 18018518
Alignment:
| Q |
18 |
gttattgtggattgccatcgttggagtcacaaaattgtgtgattgacttctgccacaacatctctgtttcatattgtattgtcgcatttaatcaatagtg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18018710 |
gttattgtggattgccatcgttggagtcacaaaattgtgtgattgacttctgccacaacatctctgtttcatattgtattgtcgcatttaatcaatagtg |
18018611 |
T |
 |
| Q |
118 |
aaacaatgaagctggaaattctatctctattatttgcttgaatcatcacacaaattcaaactagactagtcattttggatcgacattatcatc |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18018610 |
aaacaatgaagctggaaattctatctctattatttgcttgaatcatcacacaaattcaaactagactagtcattttggatcgacattatcatc |
18018518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 37 - 206
Target Start/End: Complemental strand, 19378580 - 19378427
Alignment:
| Q |
37 |
gttggagtcacaaaattgtgtgattgacttctgccacaacatctctgtttcatattgtattgtcgcatttaatcaatagtgaaacaatgaagctggaaat |
136 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||| ||| | | ||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19378580 |
gttggggtcacaaaattgtgtgattgactt-tgcaacatcctttctgtttcatattgtattgtcgcatttaatcaatattgaaacaatgaagctgg---- |
19378486 |
T |
 |
| Q |
137 |
tctatctctattatttgcttgaatcatcacacaaattcaaactagactagtcattttggatcgacattat |
206 |
Q |
| |
|
|||||||||| |||||| | || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
19378485 |
-----------catttgcttgactcatcagataatttcaaactagactagtcattttggatcgacattat |
19378427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University