View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4585_low_6 (Length: 307)
Name: NF4585_low_6
Description: NF4585
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4585_low_6 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 230; Significance: 1e-127; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 230; E-Value: 1e-127
Query Start/End: Original strand, 2 - 277
Target Start/End: Original strand, 17283051 - 17283325
Alignment:
| Q |
2 |
caatttatgggaaagaattggtgtgtatttcttaatttcactgaatacaagtggccttgattctaaatattttccttctttttccagcaaagataaaata |
101 |
Q |
| |
|
||||||||| ||||||||||| |||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
17283051 |
caatttatgtgaaagaattggggtgtattttttaatgtcactgaatacaagtggccttgattctaaatattttccttcttttttcagcaaagataaaata |
17283150 |
T |
|
| Q |
102 |
atgtcctcgaataactaagtcaattacaatcagacaacaaaaatacnnnnnnngaatatatgcaacactgcacctctgaaaaggaggattgcagtaacga |
201 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17283151 |
atgtcctcgaataactaagtcaattacaatcagacaacaaaaatac-aaaaaagaatatatgcaacactgcacctctgaaaaggaggattgcagtaacga |
17283249 |
T |
|
| Q |
202 |
catcaattattataaaataaacttgacagaatatctcaattctcaattcccatgtagatcattttaccatatgcaa |
277 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17283250 |
catcaattattataaaataaacttgacagaatatctcaattctcaattcccatgtagatcattttaccatatgcaa |
17283325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University