View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4586_high_19 (Length: 347)
Name: NF4586_high_19
Description: NF4586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4586_high_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 274; Significance: 1e-153; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 20 - 343
Target Start/End: Complemental strand, 39242455 - 39242133
Alignment:
| Q |
20 |
ggttgttgcacacgtgtagtggtcttgttttcttcgcagccaaattgtcgatgcacccaaga-agatatatactcttaactctct-atgtagtaaaagag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
39242455 |
ggttgttgcacacgtgtagtggtcttgttttcttcgcagccaaattgtcgacgcacccaagatagatatatactct-aactctcttatgtagtaaaagag |
39242357 |
T |
 |
| Q |
118 |
agaaacgttcaaaaatggaattagctccactaatgtaaacccaccctttttcgtcgcccattctattctaccaaaatcactaaacaatattccttcaatc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39242356 |
agaaacgttcaaaaatggaattagctccactaatgtaaacccaccctttttc-tcgcccattctattctaccaaaatcactaaacaatattccttcaatc |
39242258 |
T |
 |
| Q |
218 |
aattcttctttctctcccacaacatttaccgcagattctttaacccaactcaacaatcgatattaagagttatatccacatgattaattgatttttcaaa |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
39242257 |
aattcttctttctctcccacaacatttaccgcagattctttaacccaactcaacaatcgatattaagagttatatccacatgattaattga-ttttcaaa |
39242159 |
T |
 |
| Q |
318 |
tagtattaatgtaacctttgcttctc |
343 |
Q |
| |
|
||||||| |||||||||||| ||||| |
|
|
| T |
39242158 |
tagtattgatgtaacctttgattctc |
39242133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University