View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4586_high_42 (Length: 254)
Name: NF4586_high_42
Description: NF4586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4586_high_42 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 25 - 254
Target Start/End: Original strand, 36970566 - 36970796
Alignment:
| Q |
25 |
aactccaagattgatttgaaggagcaaaccctacttaaagatacgctagaaaagcgtggattttatgagttctcttttgtagtccaatccgtaacgaaat |
124 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36970566 |
aactccaagattgatttgaaggagcaaaccctacttaaagatactctagaaaagcatggattttatgagttctcttttgtagtccaatccgtaacgaaat |
36970665 |
T |
 |
| Q |
125 |
agaagcnnnnnnn-catttgacttttaaaacccttttaactgcttatattttcttaccgatgactactatgtttggtacttggatttgttgcatcttctt |
223 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36970666 |
agaagcaaaaaaaacatttgacttttaaaacccttttaactgcttgtattttcttaccgatgactactatgtttggtacttggatttgttgcatcttctt |
36970765 |
T |
 |
| Q |
224 |
caaacttgtcttttgcagtttcatgaagttt |
254 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
36970766 |
caaacttgtcttttgcagtttcatgaagttt |
36970796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University