View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4586_high_54 (Length: 238)
Name: NF4586_high_54
Description: NF4586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4586_high_54 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 34 - 211
Target Start/End: Original strand, 7139415 - 7139592
Alignment:
| Q |
34 |
actctattcatcttttatatgatacatatgtgggtatctatgaagtaacttaattataagtatttgataaaatatttcttnnnnnnnnnnnnnnnntaca |
133 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
7139415 |
actctagtcatcttttatatgatacatatgtgggtatctatgaagtaacttaattataagtatttgataaaatatttcttaaaaataaataaaaaataca |
7139514 |
T |
|
| Q |
134 |
tactttaagggtacacatatccatgagtatctatagagtatcgatatttgatacgtattcgatacggatatgtagtat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7139515 |
tactttaagggtacacatatccatgagtatctatagagtatcgatatttgatacgtattcgatacggatatgtagtat |
7139592 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University