View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4586_low_24 (Length: 337)
Name: NF4586_low_24
Description: NF4586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4586_low_24 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 5e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 5e-87
Query Start/End: Original strand, 139 - 337
Target Start/End: Original strand, 14438183 - 14438381
Alignment:
| Q |
139 |
acaaataaatctttctttagcatagcatgaagttcaatcgagtaaatattaggcttaaatgcaattttagcattcaactttcataaatgtgtaattttgg |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||||||||| |||||||||||||||| | |
|
|
| T |
14438183 |
acaaataaatctttctttagcatagcatgaagttcaatcgagtaaatattaagcttaaatgcagttttagccttcaacttttataaatgtgtaattttag |
14438282 |
T |
 |
| Q |
239 |
cctcatagtttattttatgcaattttaatcccccaagtttatctttttcatgatttccctttgctgattttatagccccctacttatacgtggttggat |
337 |
Q |
| |
|
|| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
14438283 |
ccccatagtttattttgtgcaattttaatcccccaagtttatctttttcatgatttcccttttctgattttaaagccccctacttatacgtggttggat |
14438381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 213 - 286
Target Start/End: Original strand, 24428721 - 24428795
Alignment:
| Q |
213 |
caactttcataaatgtgtaattttggcc-tcatagtttattttatgcaattttaatcccccaagtttatcttttt |
286 |
Q |
| |
|
||||||| ||| ||||| |||||||||| || || |||||||||||||||||||||| || ||||||||| |||| |
|
|
| T |
24428721 |
caacttttatatatgtgcaattttggccctcctaatttattttatgcaattttaatctcctaagtttatcctttt |
24428795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University