View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4586_low_29 (Length: 292)
Name: NF4586_low_29
Description: NF4586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4586_low_29 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 135; Significance: 2e-70; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 112 - 250
Target Start/End: Original strand, 48284840 - 48284978
Alignment:
| Q |
112 |
aaatggattcttcttgattttacttataattttgtgtactgtatcaaccacactaaaatgaaatttattcattcacctttcgtgtcaattacagaggcca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48284840 |
aaatggattcttcttgattttacttataattttgtgtactgtatcaaccacactaaaatgaaatttattcattcacctttcgtgtcaattacagaggcca |
48284939 |
T |
 |
| Q |
212 |
tttggcatcgatctgttttccaagggaagactttgtgat |
250 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
48284940 |
tttggcattgatctgttttccaagggaagactttgtgat |
48284978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 22 - 79
Target Start/End: Original strand, 48284693 - 48284750
Alignment:
| Q |
22 |
caattttaattttcttggcaaccctatcattctggcaactgggagcggattccatact |
79 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48284693 |
caattttaattttcttggcaaccctatcattctggcaactgggagcggattccatact |
48284750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 76 - 113
Target Start/End: Original strand, 48284772 - 48284809
Alignment:
| Q |
76 |
tactcacccatataattgtaagtttgtgtatgtttgaa |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48284772 |
tactcacccatataattgtaagtttgtgtatgtttgaa |
48284809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University