View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4586_low_41 (Length: 255)
Name: NF4586_low_41
Description: NF4586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4586_low_41 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 154; Significance: 9e-82; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 70 - 243
Target Start/End: Complemental strand, 48284646 - 48284473
Alignment:
| Q |
70 |
agtgaactctgaattcattgtgttctgttattttccttttgaactttgtgtctcgttattccaacccattttggggattgttgactgacttgattttggt |
169 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| | |||||||||||||||||||||||| |
|
|
| T |
48284646 |
agtgaactctgaattcattgtgttctgttattttccttttgaactttgtgtctcgttattccaacccgttttgcgaattgttgactgacttgattttggt |
48284547 |
T |
|
| Q |
170 |
ttaggatttggatccttcaccaattgtctacaattaattttaacagggttttcacagttgagctctcacaggtt |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
48284546 |
ttaggatttggatccttcaccaattgtctacaattaattttaacagggttttcatagttgagctctcgcaggtt |
48284473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 48
Target Start/End: Complemental strand, 48284687 - 48284643
Alignment:
| Q |
1 |
tctgctagagctctaggtggttgaacacgaagagggaagggggtagtg |
48 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
48284687 |
tctgctagagctctaggt---tgaacacgaagagggaagggggtagtg |
48284643 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University