View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4586_low_46 (Length: 252)
Name: NF4586_low_46
Description: NF4586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4586_low_46 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 237
Target Start/End: Complemental strand, 13990327 - 13990091
Alignment:
| Q |
1 |
tgaaaatttactacacataataattgaacatatccatcctcaccttattcttgttgtacattagtcaatacaggactttagtcaaaggttnnnnnnnntg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
13990327 |
tgaaaatttactacacataataattgaacatatccatcctcaccttattcttgttgtacattagtcaatacaggactttagtcaaaggttaaaaaaaatg |
13990228 |
T |
 |
| Q |
101 |
tgcacgaataaatttggccaaacaaattagtaaaatcaaacacttttctgtcaaagtgaatccaccaaggtcagccctagtgaacaagtgatctttatac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13990227 |
tgcacgaataaatttggccaaacaaattagtaaaatcaaacacttttctgtcaaagtgaatccaccaaggtcagccctagtgaacaagtgatctttatac |
13990128 |
T |
 |
| Q |
201 |
gtatattcttatctttttctttattttattactattc |
237 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
13990127 |
gtatattcttctctttttctttattttattactattc |
13990091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University