View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF4586_low_53 (Length: 242)
Name: NF4586_low_53
Description: NF4586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF4586_low_53 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 207; Significance: 1e-113; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 24941276 - 24941497
Alignment:
| Q |
1 |
tgttcctgtgccccgttttaataccattccttcttgtgaatgaacatataggtgattgagcacacaggagaatcctcagttgcatgagttccccatcacg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
24941276 |
tgttcctgtgccccgttttaataccattccttcttgtgaatgaacatataggtgattgagcacacaggagaatcctcagttgcatgtgttccccatcacg |
24941375 |
T |
 |
| Q |
101 |
atcattatattatctctatcaactttcactctgaaattattacatgtcatgtattggtgtatttgtgtttatattcttaatcttaatactttgagaatta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24941376 |
atcattatattatctctatcaactttcactctgaa---attacatgtcatgtattggtgtatttgtgtttatattcttaatcttaatactttgagaatta |
24941472 |
T |
 |
| Q |
201 |
agataggattgacggcgtaacttgt |
225 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
24941473 |
agataggattgacggcgtaacttgt |
24941497 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 44
Target Start/End: Original strand, 25169712 - 25169755
Alignment:
| Q |
1 |
tgttcctgtgccccgttttaataccattccttcttgtgaatgaa |
44 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||| |||||||||| |
|
|
| T |
25169712 |
tgttcctgtgccgcgttttaatagcattccttcgtgtgaatgaa |
25169755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University