View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF4586_low_55 (Length: 238)

Name: NF4586_low_55
Description: NF4586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF4586_low_55
NF4586_low_55
[»] chr5 (1 HSPs)
chr5 (34-211)||(7139415-7139592)


Alignment Details
Target: chr5 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 34 - 211
Target Start/End: Original strand, 7139415 - 7139592
Alignment:
34 actctattcatcttttatatgatacatatgtgggtatctatgaagtaacttaattataagtatttgataaaatatttcttnnnnnnnnnnnnnnnntaca 133  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||                ||||    
7139415 actctagtcatcttttatatgatacatatgtgggtatctatgaagtaacttaattataagtatttgataaaatatttcttaaaaataaataaaaaataca 7139514  T
134 tactttaagggtacacatatccatgagtatctatagagtatcgatatttgatacgtattcgatacggatatgtagtat 211  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
7139515 tactttaagggtacacatatccatgagtatctatagagtatcgatatttgatacgtattcgatacggatatgtagtat 7139592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University